bcor

Ensembl ID:
ENSDARG00000017798
ZFIN ID:
ZDB-GENE-040408-1
Description:
BCL-6 corepressor [Source:RefSeq peptide;Acc:NP_991189]
Human Orthologue:
BCOR
Human Description:
BCL6 corepressor [Source:HGNC Symbol;Acc:20893]
Mouse Orthologue:
Bcor
Mouse Description:
BCL6 interacting corepressor Gene [Source:MGI Symbol;Acc:MGI:1918708]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24091 Nonsense Mutation detected in F1 DNA During 2014
sa24092 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047442 Nonsense 355 1777 3 13
ENSDART00000102106 Nonsense 355 1796 3 14
Genomic Location:
Chromosome 22 (position 11265620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTACTATGGAGTTCCAGAAGCCTCTGTACAGAAGTCCTTCCTCATCCT[C/A]ATCATCTTCACCATCAGTATCTCACCCTGTCTATATTAGCAGTGCATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047442 Essential Splice Site 1630 1777 12 13
ENSDART00000102106 Essential Splice Site 1649 1796 13 14
Genomic Location:
Chromosome 22 (position 11302984)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACACCTTGTCTCTCATTTCTAATCGATATCTGTCTCTCTGACTCAC[A/T]GAGCCTGCCGACGACTCGTCTGGGTACGATATCCTGGCCAACCCTCCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047442 Nonsense 1770 1777 13 13
ENSDART00000102106 Nonsense 1789 1796 14 14
Genomic Location:
Chromosome 22 (position 11309878)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGTGGCGCTGCTGGGGTCATCGATTGAATGCTTGGACGACCGCTGG[G/T]AACCCGCTTCCAGACCTCGCTCCTGAACTATTGCACACGCACTCGGACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ql5er1ol