sdr16c5

Ensembl ID:
ENSDARG00000017794
ZFIN ID:
ZDB-GENE-040426-2861
Description:
short chain dehydrogenase/reductase family 16C, member 5 [Source:RefSeq peptide;Acc:NP_999936]
Human Orthologue:
SDR16C5
Human Description:
short chain dehydrogenase/reductase family 16C, member 5 [Source:HGNC Symbol;Acc:30311]
Mouse Orthologues:
Sdr16c5, Sdr16c6
Mouse Descriptions:
short chain dehydrogenase/reductase family 16C, member 5 Gene [Source:MGI Symbol;Acc:MGI:2668443]
short chain dehydrogenase/reductase family 16C, member 6 Gene [Source:MGI Symbol;Acc:MGI:2685269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7094 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049264 Nonsense 245 306 6 7
ENSDART00000129798 Nonsense 245 306 5 6
ENSDART00000144009   None 240 None 5
Genomic Location (Zv9):
Chromosome 7 (position 59958105)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58410714
KASP Assay ID:
554-4904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTATTTTGCAGATGGCCTAGACTCATGCCTATTCTTGACCCAGATTA[T/A]GCATGTAGGAAAATTGTGGATGCAATTCGAAGGGAACAGGTTTACCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link