chrnb2b

Ensembl ID:
ENSDARG00000017790
ZFIN ID:
ZDB-GENE-070821-3
Human Orthologue:
CHRNB2
Human Description:
cholinergic receptor, nicotinic, beta 2 (neuronal) [Source:HGNC Symbol;Acc:1962]
Mouse Orthologue:
Chrnb2
Mouse Description:
cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) Gene [Source:MGI Symbol;Acc:MGI:87891

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041625 None None 543 None 6
ENSDART00000143043 Nonsense 12 480 2 4
Genomic Location:
Chromosome 16 (position 24835265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACATTAAGATGAATGAAAATGCKAATTAAGTCTACCGTGGTTGTTTA[T/A]TTYCAWCTTCAGGAATGGCAGGACTACAGACTAACATGGAGCCCAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lyjnm4gv