si:dkey-158a20.2

Ensembl ID:
ENSDARG00000017780
ZFIN IDs:
ZDB-GENE-040724-215, ZDB-GENE-081103-57
Description:
Novel protein similar to vertebrate RAR-related orphan receptor family [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
RORB
Human Description:
RAR-related orphan receptor B [Source:HGNC Symbol;Acc:10259]
Mouse Orthologue:
Rorb
Mouse Description:
RAR-related orphan receptor beta Gene [Source:MGI Symbol;Acc:MGI:1343464]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa322 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa322
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122742 Nonsense 49 480 3 10
Genomic Location (Zv9):
Chromosome 2 (position 50002448)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49698218
KASP Assay ID:
554-3297.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTTCMGACGCAGCCAGCAGAATAATGCCATGTACTCGTGTTCACGG[C/T]AGAGRAACTGCCTGATTGACCGAACCAACCGCAACCGCTGCCAACACTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link