mdh1a

Ensembl ID:
ENSDARG00000017772
ZFIN ID:
ZDB-GENE-040204-1
Description:
malate dehydrogenase 1a, NAD (soluble) [Source:RefSeq peptide;Acc:NP_956241]
Human Orthologue:
MDH1
Human Description:
malate dehydrogenase 1, NAD (soluble) [Source:HGNC Symbol;Acc:6970]
Mouse Orthologue:
Mdh1
Mouse Description:
malate dehydrogenase 1, NAD (soluble) Gene [Source:MGI Symbol;Acc:MGI:97051]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18710 Nonsense Mutation detected in F1 DNA During 2014
sa7915 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012842 Nonsense 257 304 9 10
ENSDART00000022290 Nonsense 286 333 8 9
ENSDART00000140657 Nonsense 36 74 2 2
ENSDART00000140982 None None 46 None 2
ENSDART00000012842 Nonsense 257 304 9 10
ENSDART00000022290 Nonsense 286 333 8 9
ENSDART00000140657 Nonsense 36 74 2 2
ENSDART00000140982 None None 46 None 2

The following transcripts of ENSDARG00000017772 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 51497097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATCTACTCTTCTGGCAATTCCTATGGAGTTCCTGATGACCTCATGTA[C/A]TCCTTCCCTGTAAAGATCAAGGTTGGTTTTACTCGCTTTAAGGCCCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012842 Nonsense 257 304 9 10
ENSDART00000022290 Nonsense 286 333 8 9
ENSDART00000140657 Nonsense 36 74 2 2
ENSDART00000140982 None None 46 None 2
ENSDART00000012842 Nonsense 257 304 9 10
ENSDART00000022290 Nonsense 286 333 8 9
ENSDART00000140657 Nonsense 36 74 2 2
ENSDART00000140982 None None 46 None 2

The following transcripts of ENSDARG00000017772 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 51497097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATCTACTCTTCTGGMAATTCCTATGGAGTTCCTGATGACCTCATGTA[C/A]TCCTTCCCTGTAAAGATCAAGGTTGGTTTTACTCKCTTTAAGGCCCTTTY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ufuswb9