arhgap29b

Ensembl ID:
ENSDARG00000017748
ZFIN ID:
ZDB-GENE-031010-44
Description:
Rho GTPase-activating protein 29 [Source:UniProtKB/Swiss-Prot;Acc:Q6PCS4]
Human Orthologue:
ARHGAP29
Human Description:
Rho GTPase activating protein 29 [Source:HGNC Symbol;Acc:30207]
Mouse Orthologue:
Arhgap29
Mouse Description:
Rho GTPase activating protein 29 Gene [Source:MGI Symbol;Acc:MGI:2443818]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18561 Essential Splice Site Available for shipment Available now
sa9978 Nonsense Available for shipment Available now
sa6007 Nonsense Mutation detected in F1 DNA During 2014
sa18723 Nonsense Mutation detected in F1 DNA During 2014
sa9335 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016071 Essential Splice Site 325 1337 10 24
ENSDART00000141921 Essential Splice Site 325 1337 10 23
Genomic Location:
Chromosome 2 (position 14991766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACAARTCAATTCCTTAAATTCCACACATTTTCCCCTTATTCCAACA[G/A]CCACTGCTGGCCCGCAAGAATGACCTGGACAAGCAGAGGAAAGAGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016071 Nonsense 343 1337 10 24
ENSDART00000141921 Nonsense 343 1337 10 23
Genomic Location:
Chromosome 2 (position 14991821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGCCCGCAAGAATGACCTGGACAAGCAGAGGAAAGAGATTAAAGAA[C/T]AATGGCAAAGAGAGCTGAAGAAAATGGTACTAATGCCTATTTGAATTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016071 Nonsense 414 1337 12 24
ENSDART00000141921 Nonsense 414 1337 12 23
Genomic Location:
Chromosome 2 (position 14994766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGATGGTCTGTTTTTGTGGTAACTCCAGGCAGAGGAAGCGCAGGAG[C/T]AGTATAAAGCCTGTGTGGCYGATCTGGAGGCCAAGAAGGTCAGCCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016071 Nonsense 1037 1337 23 24
ENSDART00000141921 Nonsense 1037 1337 23 23
ENSDART00000016071 Nonsense 1037 1337 23 24
ENSDART00000141921 Nonsense 1037 1337 23 23
Genomic Location:
Chromosome 2 (position 15015301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTTTTTTCTCAAGCAGGTGAGGGCTCAGATGTCAACGGGGTTGGTT[T/A]GACTTCTGTTGACTCCACATCTGTGTTCAACCGGCCTGGTGCCAGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016071 Nonsense 1037 1337 23 24
ENSDART00000141921 Nonsense 1037 1337 23 23
ENSDART00000016071 Nonsense 1037 1337 23 24
ENSDART00000141921 Nonsense 1037 1337 23 23
Genomic Location:
Chromosome 2 (position 15015301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTTTTTYTCTCAARCAGGTGAGGGCTCAGATGTCAACGGGGTTGGTT[T/A]GACTTCTGTTGACTCCACATCTGTGTTCAAYCGGCCTGGTGCCAGCAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kcci8c9j