g3bp1

Ensembl ID:
ENSDARG00000017741
ZFIN ID:
ZDB-GENE-030131-7452
Description:
ras GTPase-activating protein-binding protein 1 [Source:RefSeq peptide;Acc:NP_956250]
Human Orthologue:
G3BP1
Human Description:
GTPase activating protein (SH3 domain) binding protein 1 [Source:HGNC Symbol;Acc:30292]
Mouse Orthologue:
G3bp1
Mouse Description:
Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1351465]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38997 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018651 Essential Splice Site 199 354 None 8
ENSDART00000139855   None 477 None 12
ENSDART00000143518 Essential Splice Site 128 283 None 6
ENSDART00000145850   None 186 None 5
ENSDART00000147991   None 158 None 4

The following transcripts of ENSDARG00000017741 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 26937666)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25630868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACAGAACACCAAGGCCCGGAGGTGTGCAAAATTCTAATGAACTGAG[T/A]ATGGAAGCACATTTTGAGGCTTTTTTTTTTCTTTCTTTTTTCATTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link