LOC100004742

Ensembl ID:
ENSDARG00000017722
Human Orthologue:
CHRM4
Human Description:
cholinergic receptor, muscarinic 4 [Source:HGNC Symbol;Acc:1953]
Mouse Orthologue:
Chrm4
Mouse Description:
cholinergic receptor, muscarinic 4 Gene [Source:MGI Symbol;Acc:MGI:88399]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38007 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018239 Nonsense 321 424 1 1
Genomic Location (Zv9):
Chromosome 25 (position 8146699)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7759223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGAAGAACTCGACTGAAACGAACAGGAAAACACAAGCTGACTGTCTT[C/T]AAACCAATAGTGGCGTTCAGGTTCAAAGGCAAACATCCAATATGGTCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link