si:ch211-106h11.1

Ensembl ID:
ENSDARG00000017720
ZFIN ID:
ZDB-GENE-061009-2
Description:
Novel protein similar to vertebrate leucine rich repeat containing 8 family [Source:UniProtKB/TrEMBL
Human Orthologues:
LRRC8A, LRRC8B, LRRC8C, LRRC8D, LRRC8E
Human Descriptions:
leucine rich repeat containing 8 family, member A [Source:HGNC Symbol;Acc:19027]
leucine rich repeat containing 8 family, member B [Source:HGNC Symbol;Acc:30692]
leucine rich repeat containing 8 family, member C [Source:HGNC Symbol;Acc:25075]
leucine rich repeat containing 8 family, member D [Source:HGNC Symbol;Acc:16992]
leucine rich repeat containing 8 family, member E [Source:HGNC Symbol;Acc:26272]
Mouse Orthologues:
Lrrc8a, Lrrc8b, Lrrc8c, Lrrc8d, Lrrc8e
Mouse Descriptions:
leucine rich repeat containing 8 family, member B Gene [Source:MGI Symbol;Acc:MGI:2141353]
leucine rich repeat containing 8 family, member C Gene [Source:MGI Symbol;Acc:MGI:2140839]
leucine rich repeat containing 8 family, member E Gene [Source:MGI Symbol;Acc:MGI:1919517]
leucine rich repeat containing 8A Gene [Source:MGI Symbol;Acc:MGI:2652847]
leucine rich repeat containing 8D Gene [Source:MGI Symbol;Acc:MGI:1922368]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12678 Nonsense Available for shipment Available now
sa19935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009883   None 808 None 7
ENSDART00000145866 Nonsense 192 857 2 6
Genomic Location (Zv9):
Chromosome 3 (position 6179249)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5751692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAATTGTTGAWTATGTCTAGGTAGCTTCATCGTACAAAATGCGCAAGT[C/A]GAGTTTGGACTCGGGAACGGACAGCCYTCTGCTGGCAGGAATTGACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009883 Nonsense 520 808 6 7
ENSDART00000145866 Nonsense 551 857 5 6
Genomic Location (Zv9):
Chromosome 3 (position 6170170)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5742613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTCTGCGGGGCCTTCAGGAGCTCCAGCTGACGGGGCGGCTGGGCAGC[G/T]AGGGCGGGATGGGGCGCGGATGGACCCTCGGAAGTCTCCGACAGCTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link