lrrc40

Ensembl ID:
ENSDARG00000017708
ZFIN ID:
ZDB-GENE-030131-6062
Description:
Leucine-rich repeat-containing protein 40 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXW3]
Human Orthologue:
LRRC40
Human Description:
leucine rich repeat containing 40 [Source:HGNC Symbol;Acc:26004]
Mouse Orthologue:
Lrrc40
Mouse Description:
leucine rich repeat containing 40 Gene [Source:MGI Symbol;Acc:MGI:1914394]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14971 Essential Splice Site Available for shipment Available now
sa10669 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022586 Essential Splice Site 49 601 2 15

The following transcripts of ENSDARG00000017708 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 29828043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GNNNNNNTAATCATGATATTTTGGTGATKGTTATTAATGGTATTTGTTCA[G/A]TTCCTGCTAGTGTATGGAGGTTGAACTTAGACACACCYCAGGAAGCCAGNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022586 Nonsense 79 601 2 15

The following transcripts of ENSDARG00000017708 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 29828133)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGCCAAGCAAAATRTKTCTTTTGGAGCTGAAGATCGGTGGTGGGAA[C/T]AGACTGATCTGACCAAACTGCTTCTGTCCTCCAACAAACTCCAGAGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ijnakd1a