def

Ensembl ID:
ENSDARG00000017696
ZFIN ID:
ZDB-GENE-021217-2
Description:
Digestive organ expansion factor [Source:UniProtKB/Swiss-Prot;Acc:Q6PEH4]
Human Orthologue:
C1orf107
Human Description:
chromosome 1 open reading frame 107 [Source:HGNC Symbol;Acc:28440]
Mouse Orthologue:
AA408296
Mouse Description:
expressed sequence AA408296 Gene [Source:MGI Symbol;Acc:MGI:2138080]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10886 Nonsense Available for shipment Available now
sa1495 Essential Splice Site Available for shipment Available now
sa35530 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026726 Nonsense 153 753 4 13
Genomic Location (Zv9):
Chromosome 13 (position 32160199)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31806147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTACAGAAAAAACACMCTGAAAAGACCAATGGAGATGTAGAGGAGAAT[G/T]AAGAGGCAGAGATGGAGGGAGAGTTTACAGATAAAAAGAATGAAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026726 Essential Splice Site 421 753 8 13
Genomic Location (Zv9):
Chromosome 13 (position 32158815)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31804763
KASP Assay ID:
554-1420.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTACCACGCTGTCTTTTCTGGAAATATAGATGATCATTTCAGGATAGG[T/A]ATGAAAAAGCATTTCCTTTTTTAACTGAAACTTTTTCTGTCTTTTTCTTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026726 Nonsense 655 753 12 13
Genomic Location (Zv9):
Chromosome 13 (position 32151925)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31797873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATCAGAGGTGTCTCGAGCGCGACATTACTTCCAGAAAGGAGAAAAA[C/T]AGTTTCTGCTCTTCTCTGAGAGATTCCACTTTTATAAGAGGTAGGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link