mapk4

Ensembl ID:
ENSDARG00000017681
ZFIN ID:
ZDB-GENE-040426-2835
Description:
mitogen-activated protein kinase 4 [Source:RefSeq peptide;Acc:NP_998638]
Human Orthologue:
MAPK4
Human Description:
mitogen-activated protein kinase 4 [Source:HGNC Symbol;Acc:6878]
Mouse Orthologue:
Mapk4
Mouse Description:
mitogen-activated protein kinase 4 Gene [Source:MGI Symbol;Acc:MGI:2444559]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17727 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020621 Nonsense 417 674 7 7
ENSDART00000133955 None None 246 None 5
Genomic Location:
Chromosome 8 (position 30611574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGCGCAGGTAGACCCTCGCAAGTACKCCCACAGCAGCTCTGCAGAG[C/T]GATTCCTGGAGCAGTCACACCCATCCCTGGAGCGCATCTGTGGACACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5acubv3c