mmp2

Ensembl ID:
ENSDARG00000017676
ZFIN ID:
ZDB-GENE-030131-9123
Description:
72 kDa type IV collagenase [Source:RefSeq peptide;Acc:NP_932333]
Human Orthologue:
MMP2
Human Description:
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) [Source:HGNC S
Mouse Orthologue:
Mmp2
Mouse Description:
matrix metallopeptidase 2 Gene [Source:MGI Symbol;Acc:MGI:97009]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2404 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1218 Nonsense Available for shipment Available now
sa21006 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Essential Splice Site 587 657 12 13
Genomic Location:
Chromosome 7 (position 36869134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGTAGAAATGTGTTGATCCTGATGTGTAAATGCTCACTTCTTTCCTC[A/T]GATACAATGAAGCCAAGAAAAAGATGGATCCAGGCTTCCCTAAAATTATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Nonsense 630 657 13 13
Genomic Location:
Chromosome 7 (position 36865663)
KASP Assay ID:
554-1127.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGGTATTAACACGTATGAACTGTTTTTAGGTCACAGCTACTTCTTC[A/T]AAGACTCACACTATCTCAAAATGGATGACAGCACTCTGAAAATTATCAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Nonsense 654 657 13 13
Genomic Location:
Chromosome 7 (position 36865589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACAGCACTCTGAAAATTATCAAAGTCGGCGAGGTCAAAAAGGACTG[G/A]CTGCGCTGCTGAACATCGACAGACCATTCAGCTCTATGCCCTTCAACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/huwhys5z