cirh1a

Ensembl ID:
ENSDARG00000017675
ZFIN ID:
ZDB-GENE-040426-2466
Description:
cirhin [Source:RefSeq peptide;Acc:NP_998447]
Human Orthologue:
CIRH1A
Human Description:
cirrhosis, autosomal recessive 1A (cirhin) [Source:HGNC Symbol;Acc:1983]
Mouse Orthologue:
Cirh1a
Mouse Description:
cirrhosis, autosomal recessive 1A (human) Gene [Source:MGI Symbol;Acc:MGI:1096573]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23255 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2978 Essential Splice Site F2 line generated During 2014
sa6505 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Essential Splice Site 116 685 3 17
Genomic Location:
Chromosome 18 (position 14207681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCCAATCTGGGCCATAACAGGCAATCAACAAGGAACACACTTGGCGG[T/C]AAGTTTGGTTTGTTTACTACGATCATGTATTCAATAATTCAAAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2978
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Essential Splice Site 303 685 7 17
ENSDART00000010821 Essential Splice Site 303 685 7 17
Genomic Location:
Chromosome 18 (position 14211069)
KASP Assay ID:
554-3265.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGATGTTCGAGCTGTGGCTGAGATCACAACAGCTGTGGTTTCAGGAGG[C/A]GAGTTAATTTTTTTCATTTAATAGTTAAAACAGTCAATCTATCAGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Nonsense 539 685 14 17
Genomic Location:
Chromosome 18 (position 14216282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATACAGTTCAGCTGTCAGTGCCATGGCCATCCATCCAACAACAAACTG[T/A]CTGTTCATGGTTCATGCAGATCAACAGGTAATCTGCAACCTGCACATRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9kbd7vwo