nova2

Ensembl ID:
ENSDARG00000017673
ZFIN ID:
ZDB-GENE-080211-1
Description:
Neurological oncogenic ventral antigen protein [Source:UniProtKB/TrEMBL;Acc:Q53B45]
Human Orthologue:
NOVA2
Human Description:
neuro-oncological ventral antigen 2 [Source:HGNC Symbol;Acc:7887]
Mouse Orthologue:
Nova2
Mouse Description:
neuro-oncological ventral antigen 2 Gene [Source:MGI Symbol;Acc:MGI:104296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16605 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060244 Nonsense 7 473 1 5
Genomic Location (Zv9):
Chromosome 15 (position 28035387)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28753627
KASP Assay ID:
2260-8621.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGTGCAGCAAAACGGGATTTTCTCCAATCCRYATCATCACAATCAA[C/T]AGCCGCACATGGAGTCTGATCCCCCCGATTCCCGCAAAAGACCCCTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link