braf

Ensembl ID:
ENSDARG00000017661
ZFIN ID:
ZDB-GENE-040805-1
Description:
serine/threonine-protein kinase B-raf [Source:RefSeq peptide;Acc:NP_991307]
Human Orthologue:
BRAF
Human Description:
v-raf murine sarcoma viral oncogene homolog B1 [Source:HGNC Symbol;Acc:1097]
Mouse Orthologue:
Braf
Mouse Description:
Braf transforming gene Gene [Source:MGI Symbol;Acc:MGI:88190]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20232 Essential Splice Site Available for shipment Available now
sa33418 Nonsense Available for shipment Available now
sa33417 Nonsense Available for shipment Available now
sa20231 Essential Splice Site Available for shipment Available now
sa40247 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20230 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023894 Essential Splice Site 390 777 8 19
ENSDART00000048391 Essential Splice Site 390 817 8 20
ENSDART00000131168 Essential Splice Site None 358 15 26
ENSDART00000132650 Essential Splice Site 390 575 8 13
Genomic Location (Zv9):
Chromosome 4 (position 11150015)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12086642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGCCCCTAACGTCCATATCAACACCATTGAGCCGGTCAACATTGAT[G/T]TGAGAATGATATTTTAGTCAAAAGGATTTAATCCCTTTTGAATAGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023894   None 777 None 19
ENSDART00000048391 Nonsense 417 817 10 20
ENSDART00000131168   None 358 None 26
ENSDART00000132650   None 575 None 13
Genomic Location (Zv9):
Chromosome 4 (position 11147798)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12084425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCCCTGCAGCCCCCTCGCAACACCCAGCCCGCTGCTTGAGGAAGAAC[C/T]GAACACGGACCTCAAGCCCCCTTCTGTCCTCCCACCCCAATGACATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023894   None 777 None 19
ENSDART00000048391 Nonsense 437 817 10 20
ENSDART00000131168   None 358 None 26
ENSDART00000132650   None 575 None 13
Genomic Location (Zv9):
Chromosome 4 (position 11147738)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12084365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAAGCCCCCTTCTGTCCTCCCACCCCAATGACATTGTCTTTGATTTT[G/T]AGCCTGAGCCAGTGTTCAGAGGTAGCGAGGCCGTTGTGCGTGGCCGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023894 Essential Splice Site 516 777 12 19
ENSDART00000048391 Essential Splice Site 556 817 13 20
ENSDART00000131168 Essential Splice Site None 358 19 26
ENSDART00000132650 Essential Splice Site 516 575 12 13
Genomic Location (Zv9):
Chromosome 4 (position 11143679)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12080306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACTCCACAGCAGCTACAAGCCTTTAAGAATGAAGTGGGTGTCCTCAG[G/A]TAAAAGAAAGCCTAGTGTTCCTGTAACTGGCAATGAGGATGCATCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023894 Essential Splice Site 720 777 18 19
ENSDART00000048391 Essential Splice Site 760 817 19 20
ENSDART00000131168 Essential Splice Site None 358 25 26
ENSDART00000132650   None 575 None 13
Genomic Location (Zv9):
Chromosome 4 (position 11140076)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12076703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAAATGTTTTTATTTATTAAAGATATACATGTAATTTATTTATGGCA[G/T]ATCTTGGCCTCCATCGAGTTATTGGCACGCTCTCTGCCCAAAATCCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023894 Essential Splice Site 771 777 None 19
ENSDART00000048391 Essential Splice Site 811 817 None 20
ENSDART00000131168 Essential Splice Site None 358 None 26
ENSDART00000132650   None 575 None 13
Genomic Location (Zv9):
Chromosome 4 (position 11139920)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12076547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATACACCTGCGCTTCCCCCAAAACACCCATTCAGGCCGGTGGCTATGG[C/T]AAGTGCACGTTCCTAATCCTCCTTCTTGACTTGTGTTGCATTCATTCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link