LOC100329245

Ensembl ID:
ENSDARG00000017649
Human Orthologue:
CDH7
Human Description:
cadherin 7, type 2 [Source:HGNC Symbol;Acc:1766]
Mouse Orthologue:
Cdh7
Mouse Description:
cadherin 7, type 2 Gene [Source:MGI Symbol;Acc:MGI:2442792]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5068 Nonsense F2 line generated During 2014
sa8860 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5068
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055488 Nonsense 36 765 1 12
Genomic Location:
Chromosome 24 (position 42792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGCTGGCAGCTCCTCTGGAGAACATGAGCTCTRCTGACAGGCGGTCC[A/T]AACACCCTGAACACCCGGAGCCCTCACAGGCTGTCCTGCAGAGGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055488 Essential Splice Site 333 765 5 12
Genomic Location:
Chromosome 24 (position 39786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCAGCACTGATGAGGAGACACRAGAGGCAGTCATTATCCTCCAGCAG[G/A]TCAGACCACAGTGGCCAGCAGGAGAAATGATTCATTAGACTGATCAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d7u3ceg3