LOC100333827

Ensembl ID:
ENSDARG00000017636
Human Orthologue:
RNF167
Human Description:
ring finger protein 167 [Source:HGNC Symbol;Acc:24544]
Mouse Orthologue:
Rnf167
Mouse Description:
ring finger protein 167 Gene [Source:MGI Symbol;Acc:MGI:1917760]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1533 Nonsense F2 line generated During 2014
sa20587 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1533
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009893 Nonsense 30 403 1 9
Genomic Location:
Chromosome 5 (position 70892199)
KASP Assay ID:
554-1457.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATCCTCATCATCTTCTGCACTCTGGTGCCTTCTCCTGGTCAGGCATA[T/A]ATATATGCTGTAAGTGTCTGCTTTCAGGATTATTAACAATTTCAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009893 Nonsense 204 403 7 9
Genomic Location:
Chromosome 5 (position 70883178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATAGTCGGTGATGATGTGTGTTCTCTCTTCTGATTGGTCCAGATTGTG[C/T]GATGTGTGCAGCACCGAAAGAGACTTCGTAAAAACAGACTCTCGAAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mgq84otx