pdcb

Ensembl ID:
ENSDARG00000017634
ZFIN ID:
ZDB-GENE-031023-2
Description:
phosducin 2 [Source:RefSeq peptide;Acc:NP_001020635]
Human Orthologue:
PDC
Human Description:
phosducin [Source:HGNC Symbol;Acc:8759]
Mouse Orthologue:
Pdc
Mouse Description:
phosducin Gene [Source:MGI Symbol;Acc:MGI:98090]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11534 Nonsense Available for shipment Available now
sa6640 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008140 Nonsense 48 69 3 4
ENSDART00000062539 Nonsense 48 237 3 4
Genomic Location (Zv9):
Chromosome 20 (position 34112669)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34185182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCATGGACCAGGAGGCTCTGCCACCCAATAAGAGGGAGCTGCTAAGA[C/T]AGATGTCGTCCCCACAGAAACCCAAAGACTCCTGCGTGGGTGGACTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008140   None 69 None 4
ENSDART00000062539 Nonsense 80 237 4 4
Genomic Location (Zv9):
Chromosome 20 (position 34110939)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34183452
KASP Assay ID:
554-5335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTTCTCAGATGAGCGCTCAGGAATATGAACTGATAAAGGAAGAAGAC[G/T]AGAAAAGCCTGCGCAAGTACCGTAAGCAGTGYATGCARGAGATGCAYGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link