tlx3b

Ensembl ID:
ENSDARG00000017615
ZFIN ID:
ZDB-GENE-021021-1
Description:
T-cell leukemia, homeobox 3b [Source:RefSeq peptide;Acc:NP_739572]
Human Orthologues:
TLX2, TLX3
Human Descriptions:
T-cell leukemia homeobox 2 [Source:HGNC Symbol;Acc:5057]
T-cell leukemia homeobox 3 [Source:HGNC Symbol;Acc:13532]
Mouse Orthologues:
Tlx2, Tlx3
Mouse Descriptions:
T-cell leukemia, homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1350935]
T-cell leukemia, homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:1351209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41648 Nonsense Mutation detected in F1 DNA During 2016
sa2555 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa41648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016575 Nonsense 41 300 1 3
Genomic Location (Zv9):
Chromosome 10 (position 22256925)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22087263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTTCGGCATTGACCAGATTCTCAGCGGAACCGATCAAGAATCACAG[C/T]AGAACTCGACCAGGAATAGTTCGGAGAGCAGCAGTGGCAGTAGCAGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2555
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016575 Nonsense 209 300 2 3
Genomic Location (Zv9):
Chromosome 10 (position 22254322)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22084660
KASP Assay ID:
554-3065.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTCACAGACAAAAATACCTGGCCAGCGCTGAACGGGCAGCTTTGGCC[A/T]AAACTCTAAAGATGACAGACGCACAGGTCAAAACATGGTTTCAGAACCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link