pnpo

Ensembl ID:
ENSDARG00000017612
ZFIN ID:
ZDB-GENE-060602-2
Description:
Pnpo protein [Source:UniProtKB/TrEMBL;Acc:Q6PG36]
Human Orthologue:
PNPO
Human Description:
pyridoxamine 5'-phosphate oxidase [Source:HGNC Symbol;Acc:30260]
Mouse Orthologue:
Pnpo
Mouse Description:
pyridoxine 5'-phosphate oxidase Gene [Source:MGI Symbol;Acc:MGI:2144151]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42050 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa35310 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022724 Splice Site, Nonsense 151 229 5 7
Genomic Location (Zv9):
Chromosome 12 (position 30350493)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28687430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGATCGGTGCTGTTGTGAGCAGGCAGAGTACAGTAATACCCAGCCGA[C/T]AAGTGAGTATCATCTTCAACCACCGTCCATGGTTATTAGTTAAATAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022724 Nonsense 178 229 7 7
Genomic Location (Zv9):
Chromosome 12 (position 30353895)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28690832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACCAGAAGCATTATACTTACTTTTTTTTTTCTCTCCAGGGGTGGATA[C/A]ATTGTGAAACCCTCCCTGATTGAGTTTTGGCAGGGTCAGACTAACAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link