ccdc6b

Ensembl ID:
ENSDARG00000017595
ZFIN IDs:
ZDB-GENE-040426-869, ZDB-GENE-040426-869
Description:
coiled-coil domain containing 6b [Source:RefSeq peptide;Acc:NP_956535]
Human Orthologue:
CCDC6
Human Description:
coiled-coil domain containing 6 [Source:HGNC Symbol;Acc:18782]
Mouse Orthologue:
Ccdc6
Mouse Description:
coiled-coil domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1923801]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35210 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126219 Nonsense 350 437 8 10
ENSDART00000126712 Nonsense 350 437 8 9
Genomic Location (Zv9):
Chromosome 12 (position 8276637)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7582513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGCTGACTGTGCGTACCTCTTTTGTTTTATTCTGCAGGACTGTCGTA[T/A]GTAAGTCACACAGTGGGCTTTACTCCACCAACTACGCTTACCAGAGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link