fat1

Ensembl ID:
ENSDARG00000017591
ZFIN ID:
ZDB-GENE-050425-1
Description:
protocadherin Fat 1 [Source:RefSeq peptide;Acc:NP_998132]
Human Orthologue:
FAT1
Human Description:
FAT tumor suppressor homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3595]
Mouse Orthologue:
Fat1
Mouse Description:
FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14711 Nonsense Available for shipment Available now
sa12774 Essential Splice Site Available for shipment Available now
sa24837 Nonsense Mutation detected in F1 DNA During 2014
sa1140 Nonsense Available for shipment Available now
sa3359 Nonsense Mutation detected in F1 DNA During 2014
sa494 Nonsense Available for shipment Available now
sa13483 Nonsense Available for shipment Available now
sa1599 Nonsense Available for shipment Available now
sa7901 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 788 4610 2 29
ENSDART00000103262 Nonsense 788 4608 2 32
ENSDART00000145068 Nonsense 788 4611 2 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16123549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAAAGTGTTTGCTCCTCYTGATCGAGAAACAACTGATCACTATACAT[T/A]GAACATTACCGTGTATGACCTTGGAATACCCCAAAAGTCATCTTCACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Essential Splice Site 1212 4610 4 29
ENSDART00000103262 Essential Splice Site 1212 4608 4 32
ENSDART00000145068 Essential Splice Site 1212 4611 4 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16177329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYGTCTCGGAAGCTGGACAGAGAACAACAGGATGAGCACATTCTGGAGG[T/G]AAAAACACCTGGATTCCMYTTACAGTACTCNTGTTTTACAGCAGTCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1500 4610 8 29
ENSDART00000103262 Nonsense 1500 4608 8 32
ENSDART00000145068 Nonsense 1500 4611 8 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16221821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAACAAGCTAACATACACCCTCCTCAGCAGCACTGACCCATTCAGTT[T/A]ACGGAAGTTCAGGCTTGATCCCGGAACTGGGGTGTTGTACACAGCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1568 4610 9 29
ENSDART00000103262 Nonsense 1568 4608 9 32
ENSDART00000145068 Nonsense 1568 4611 9 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16222294)
KASP Assay ID:
554-1051.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACACCAACGACAACGCACCTTGGTTCTCTGGTGCRCCGTATGTGGGC[C/T]GAGTGTTTGAGTCTGCTGCCACCGGCTCTGCAGTGCTTCAGGTCTCTGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1591 4610 9 29
ENSDART00000103262 Nonsense 1591 4608 9 32
ENSDART00000145068 Nonsense 1591 4611 9 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16222363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCGGCTCTGCAGTGCTTCAGGTCTCTGCTCTTGACAAGGACAAAGGC[C/T]AGAATGCTGAGATCATCTACAGCATTGAGTCAGGTAGTCCATCTGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1994 4610 10 29
ENSDART00000103262 Nonsense 1994 4608 10 32
ENSDART00000145068 Nonsense 1994 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16224262)
KASP Assay ID:
554-0211.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCCAAGAATCATACAAGGCATTCGTGCCAGAAAATTCCTCAGAGAAG[A/T]AGACTTTAGCTGTAATTGCGGCAGTGGGAAACCAAGTCAATGAACCTTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 2511 4610 10 29
ENSDART00000103262 Nonsense 2510 4608 13 32
ENSDART00000145068 Nonsense 2511 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16225813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATGTGGTCGAGCTTCTTGAAAACTCACCTGTTGGAACACTGGTGGCT[G/T]AAGCCCAARCGACAGATGATGACTCAGGAACATATGGAAGACTTACCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 4165 4610 27 29
ENSDART00000103262 Nonsense 4163 4608 30 32
ENSDART00000145068 Nonsense 4166 4611 25 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16255178)
KASP Assay ID:
554-1540.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGGCTCCTTTAGCTGTAATTGCTCCAATGGTTACAGCGGCCAACATTG[T/A]GAACTTCGTTCCGAAATCCGCAACGAATTTGTCTCCACCTCCTGGAACAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa7901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 4347 4610 28 29
ENSDART00000103262 Nonsense 4345 4608 31 32
ENSDART00000145068 Nonsense 4348 4611 26 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16256980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGGTAATTAAAAGNTTTTTTTTGTCCTCACAGCTAAAGTGRTGGACT[T/A]GGACTCATGTTTAAGTAAAAAGCCGGTGGAGGACAGTGCATGTCACCCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0wlitfqf