nit2

Ensembl ID:
ENSDARG00000017590
ZFIN ID:
ZDB-GENE-050522-65
Description:
Omega-amidase NIT2 [Source:UniProtKB/Swiss-Prot;Acc:Q4VBV9]
Human Orthologue:
NIT2
Human Description:
nitrilase family, member 2 [Source:HGNC Symbol;Acc:29878]
Mouse Orthologue:
Nit2
Mouse Description:
nitrilase family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1261838]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38561 Nonsense Mutation detected in F1 DNA During 2017
sa11457 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042281 Nonsense 41 277 2 10
ENSDART00000132586 Nonsense 48 284 2 10
Genomic Location (Zv9):
Chromosome 6 (position 37388827)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37462585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAACACTTGTGACGGAGGCTGCAGGACAAGGTGCAAAAGTTGTTGTTT[T/G]ACCAGTGAGTATTACATCCTTGGGTTATATATTATTCACCAGTATTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042281 Essential Splice Site 42 277 2 10
ENSDART00000132586 Essential Splice Site 49 284 2 10
Genomic Location (Zv9):
Chromosome 6 (position 37388821)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37462579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGWGAMGGAGGCTGCAGGACAAGGTGCAAAAGTTGTTGTTTTACCAG[T/A]GAGTATTAYATCCTTGGGTTAWATATTATTCACCAGTATTGTATRAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link