LOC557783

Ensembl ID:
ENSDARG00000017579
Human Orthologue:
RIC8A
Human Description:
resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) [Source:HGNC Symbol;Acc:29550]
Mouse Orthologue:
Ric8
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33215 Nonsense Available for shipment Available now
sa44564 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022660 Nonsense 262 692 5 13
Genomic Location (Zv9):
Chromosome 3 (position 32606118)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32337428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGGATGAGGAGGGTGAGGAAGGACATGATGATGGTGAGATCTGGAGG[A/T]AAGAGGCGATGAAAACCCTGTGCAATGTCATCTACAACAGCCCGAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022660 Nonsense 321 692 6 13
Genomic Location (Zv9):
Chromosome 3 (position 32605837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAGCGGTCAATTTTATGAACTGCGGCTTCTGTTTTTGTTGACTGCTT[T/A]ACGGCCTGAGCTCAGGATTGAACTCTGCCAGGTAATTATAGATCATGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link