reep3l

Ensembl ID:
ENSDARG00000017569
ZFIN ID:
ZDB-GENE-051127-47
Description:
receptor accessory protein 3, like [Source:RefSeq peptide;Acc:NP_001032664]
Human Orthologue:
REEP3
Human Description:
receptor accessory protein 3 [Source:HGNC Symbol;Acc:23711]
Mouse Orthologue:
Reep3
Mouse Description:
receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39157 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011432 Essential Splice Site 36 249 3 8
Genomic Location (Zv9):
Chromosome 17 (position 19450866)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19600877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTAATTTTTCACCTTGAGTGGATGTTGTTGTGTTTATGGTTTGAC[A/T]GGTGCGATGGATGATGTACTGGATTGTGTTTGCTCTTTACACAGTGGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link