itk

Ensembl ID:
ENSDARG00000017565
ZFIN ID:
ZDB-GENE-990415-261
Description:
tyrosine-protein kinase ITK/TSK [Source:RefSeq peptide;Acc:NP_571179]
Human Orthologue:
ITK
Human Description:
IL2-inducible T-cell kinase [Source:HGNC Symbol;Acc:6171]
Mouse Orthologue:
Itk
Mouse Description:
IL2-inducible T-cell kinase Gene [Source:MGI Symbol;Acc:MGI:96621]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa863 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003993 Essential Splice Site 541 616 15 17
Genomic Location:
Chromosome 14 (position 35135703)
KASP Assay ID:
554-0765.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATCAAATTTGGGAAGTACAGCAGCAAATCAGATGTGTGGTCCTTTG[G/A]TGAGTCCATATTGATCCATGTTAATTAAAAAAGGCTTTTAAATAAGGTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d2kcai7f