banp

Ensembl ID:
ENSDARG00000017562
ZFIN ID:
ZDB-GENE-050522-54
Description:
Protein BANP [Source:UniProtKB/Swiss-Prot;Acc:Q502P7]
Human Orthologues:
AC025279.1, BANP
Human Descriptions:
BTG3 associated nuclear protein [Source:HGNC Symbol;Acc:13450]
Putative BANP-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q9H8C5]
Mouse Orthologue:
Banp
Mouse Description:
BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24707 Nonsense Mutation detected in F1 DNA During 2014
sa12976 Nonsense Available for shipment Available now
sa24708 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016310 Nonsense 7 508 2 13
Genomic Location:
Chromosome 25 (position 31456746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTTACATTTTTCTGAAATGCAGGTTTGAATGATGTCAGAGCAAGATT[T/G]AGTGGAAATAGTCCAGATTGCAGTGGCGGATTTAAATCATGAAGGACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016310 Nonsense 82 508 4 13
Genomic Location:
Chromosome 25 (position 31460074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCTGGACAGTATGGAAGCAAAGCTGCAGGTWCTTGAGGTGACCTGT[C/T]GAGGTTTAGTGGAGAAACTGGACACRGTGATGGGCAAGAACCAGTCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016310 Nonsense 370 508 9 13
Genomic Location:
Chromosome 25 (position 31485507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTCTACCCAGCAGGCCTTGCACTACGCTCTGGCTGGAGCCACGCAA[C/T]AAGTCCAGATACACCGTATAGGAGAAGACGGACAGGTGCAAGTTGTGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fbmo4e0n