LOC567057

Ensembl ID:
ENSDARG00000017545
Human Orthologue:
GABRG3
Human Description:
gamma-aminobutyric acid (GABA) A receptor, gamma 3 [Source:HGNC Symbol;Acc:4088]
Mouse Orthologue:
Gabrg3
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit gamma 3 Gene [Source:MGI Symbol;Acc:MGI:95624]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10772 Nonsense Available for shipment Available now
sa10534 Nonsense Available for shipment Available now
sa20755 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022579 Nonsense 354 447 8 9
ENSDART00000022579 Nonsense 354 447 8 9
Genomic Location:
Chromosome 6 (position 38068964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATTATTACTCCTACAGCGCCCGCAGACCAACCTGCAACAAGACCAAA[C/T]GATCGGTGAGCATTTGTTCTGCATCAGTGATTTTATGCTGCTGAGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022579 Nonsense 354 447 8 9
ENSDART00000022579 Nonsense 354 447 8 9
Genomic Location:
Chromosome 6 (position 38068964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATTATTACTCCTACAGCGCCCGCAGACCAACCTGCAACAAGACCAAA[C/T]GATCGGTGAGCATTTGTTCTGCATCAGTGATTTTATGCTGCTGAGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022579 Nonsense 357 447 9 9
Genomic Location:
Chromosome 6 (position 38063648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGAGTTCTTCAGATTGTAAGTGTGTTGTTTTTGTCCTACAGAACTA[C/A]TCGGTACTGGACGTGGGTCCTCCTCCCACTGTTATCACTCTCAACAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vq1ak8n4