prkag3

Ensembl ID:
ENSDARG00000017537
ZFIN ID:
ZDB-GENE-091204-419
Description:
PRKAG3 protein [Source:UniProtKB/TrEMBL;Acc:Q5BLG8]
Human Orthologue:
PRKAG3
Human Description:
protein kinase, AMP-activated, gamma 3 non-catalytic subunit [Source:HGNC Symbol;Acc:9387]
Mouse Orthologue:
Prkag3
Mouse Description:
protein kinase, AMP-activated, gamma 3 non-catatlytic subunit Gene [Source:MGI Symbol;Acc:MGI:189134

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8490 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39537 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024358 Essential Splice Site 66 252 3 10
ENSDART00000126468 Essential Splice Site 66 344 3 13

The following transcripts of ENSDARG00000017537 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 5037395)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5475957
KASP Assay ID:
2259-0110.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAATTCCTACCAGCTGCAAACTGGTCATTTTTGACACAACACTGCAG[G/A]TTGGGACTTAACATAATTTTAATATTTWAAATARTTTAAATGTGATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024358 Essential Splice Site 147 252 None 10
ENSDART00000126468 Essential Splice Site 147 344 None 13

The following transcripts of ENSDARG00000017537 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 5042342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCTATAAAC[A/C]GCCTCTTTGACGCCGTCTACTCTTTACTGAAGCACAAAATCCACAGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link