si:ch211-195e3.4

Ensembl ID:
ENSDARG00000017532
ZFIN ID:
ZDB-GENE-041001-167
Description:
Novel protein similar to vertebrate kinesin-like family member protein [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
KIF25
Human Description:
kinesin family member 25 [Source:HGNC Symbol;Acc:6390]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12140 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022951 Nonsense 335 592 11 15
ENSDART00000145560 Nonsense 104 300 3 7
Genomic Location (Zv9):
Chromosome 20 (position 30935134)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31006347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTCGGTGGTGGAGGTCTATAATAATGAAGTTGTGGACCTGCTGGCC[A/T]GAGATGAAGATGGGGCGACGGTTGGGGTGAAGAGAGAGGTCATTACCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link