ctdp1

Ensembl ID:
ENSDARG00000017522
ZFIN ID:
ZDB-GENE-040720-1
Description:
RNA polymerase II subunit A C-terminal domain phosphatase [Source:RefSeq peptide;Acc:NP_001002873]
Human Orthologue:
CTDP1
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 [Source:HGNC
Mouse Orthologue:
Ctdp1
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 Gene [Source:

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36797 Nonsense Mutation detected in F1 DNA During 2016
sa43245 Nonsense Mutation detected in F1 DNA During 2016
sa23474 Nonsense Mutation detected in F1 DNA During 2016
sa23473 Nonsense Mutation detected in F1 DNA During 2016
sa32238 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 203 951 5 14
Genomic Location (Zv9):
Chromosome 19 (position 12455574)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11913920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCTTGTTTATATTTTTCTTCAGGGAATCTTTCATTTCCAGCTAGGA[C/T]GAGGGGAACCTATGCTTCACACACGACTTAGACCTCACTGCAAAGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 348 951 8 14
Genomic Location (Zv9):
Chromosome 19 (position 12439061)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11897407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATCAGGGCGGACGGACTGTGGAAGGCACAGAGTCAGGACAAGAGGAA[C/T]AGAGAAATGGCCTTAGAAAATCCAGCAAGGATCATAAAACTGGGCATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 621 951 8 14
Genomic Location (Zv9):
Chromosome 19 (position 12438242)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11896588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATCCCACCAACTACCCAATGGAGCGCACCAGAGAGTGGTATCATGGC[A/T]AGGCACTGGGTGCCAAACTTTGCAAGACCTTGGTGCTCAATGCCAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 692 951 9 14
Genomic Location (Zv9):
Chromosome 19 (position 12415965)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11874311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGCTGGGAGCGAGTAGAGGAGCAACTCTTTCCTCTCAAAGAGGACTA[T/A]AACAAATCACACAGGTATTTATCTTTTACAGCCTTCTACTTCTTTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Essential Splice Site 825 951 11 14
Genomic Location (Zv9):
Chromosome 19 (position 12402507)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11860853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGCTCTACACACTCTGTAAAGAAGACCTGGACAGCATGGACAAAGAG[G/A]TTAAACGCACACATACACACACAGACTCTCAGACATAATAGTCATATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link