ctdp1

Ensembl ID:
ENSDARG00000017522
ZFIN ID:
ZDB-GENE-040720-1
Description:
RNA polymerase II subunit A C-terminal domain phosphatase [Source:RefSeq peptide;Acc:NP_001002873]
Human Orthologue:
CTDP1
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 [Source:HGNC
Mouse Orthologue:
Ctdp1
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23474 Nonsense Mutation detected in F1 DNA During 2014
sa23473 Nonsense Mutation detected in F1 DNA During 2014
sa7878 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 621 951 8 14
Genomic Location:
Chromosome 19 (position 12438242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATCCCACCAACTACCCAATGGAGCGCACCAGAGAGTGGTATCATGGC[A/T]AGGCACTGGGTGCCAAACTTTGCAAGACCTTGGTGCTCAATGCCAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 692 951 9 14
Genomic Location:
Chromosome 19 (position 12415965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGCTGGGAGCGAGTAGAGGAGCAACTCTTTCCTCTCAAAGAGGACTA[T/A]AACAAATCACACAGGTATTTATCTTTTACAGCCTTCTACTTCTTTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 801 951 11 14
Genomic Location:
Chromosome 19 (position 12402582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGGATCGAGTCCAGACGATGAGCAGCCCGGACCTTCGCGCAGAAAA[C/T]GACAGCCCAGCATGTCGGAAACCATGCCGCTCTACACACTCTGTAAAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tzkpjm02