Q08BP2_DANRE

Ensembl ID:
ENSDARG00000017504
Description:
LOC562403 protein [Source:UniProtKB/TrEMBL;Acc:Q08BP2]
Human Orthologue:
KIAA1598
Human Description:
KIAA1598 [Source:HGNC Symbol;Acc:29319]
Mouse Orthologue:
4930506M07Rik
Mouse Description:
RIKEN cDNA 4930506M07 gene Gene [Source:MGI Symbol;Acc:MGI:1918903]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20861 Essential Splice Site Available for shipment Available now
sa26886 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26885 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9626 Nonsense Available for shipment Available now
sa15465 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102567 Essential Splice Site 59 574 4 17
Genomic Location (Zv9):
Chromosome 7 (position 9560791)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8508156
KASP Assay ID:
2259-8443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTGCTTAAAGTGTCAATGCATGTTTGATTTATACAAGTACTTTCAC[A/G]GCCTCTTCTCATCTGCTGAAGGAGCTGGACGTGTTAGAAATGCAGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102567 Essential Splice Site 91 574 5 17
Genomic Location (Zv9):
Chromosome 7 (position 9554729)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8502094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAATAGAATTTATTATGTTATATAATGTCACTCTGTCTCACCCCAC[A/C]GGTGTCAAAAGACTTCAAGGTATTAAAGAGGCAAAGCCAAGCTCTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102567 Essential Splice Site 183 574 6 17
Genomic Location (Zv9):
Chromosome 7 (position 9550983)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8498348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGCAGGTGGACCTCCTTAAGAAAGAGAAGGAGGATCTGAAAGAGAAG[G/A]TATATAAGCGTCTGCAAATGAGACTCCATGACTAAACTACAGTCATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102567 Nonsense 300 574 10 17
Genomic Location (Zv9):
Chromosome 7 (position 9540771)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8488136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGATGTATAGATGTCTCWGACAGCAGCRGAGGATCTCAACTCTCTGT[C/A]AGATCTGACAGCTAYAARAACAAAACTGGAGATCAGCGAGAGAGAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102567 Essential Splice Site 460 574 14 17
Genomic Location (Zv9):
Chromosome 7 (position 9535871)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8483236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNAACCTYTGGCTTCTTTTTAGGTTGCATCTGAGGATGAAAATGCATGGAAG[G/T]TTAGTGACGSATCATTTAGTTTTATKTAAATGTATTATATGTGTGTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major CVD: Framingham Heart Study 100K project: genome-wide associations for cardiovascular disease outcomes. (View Study)
  • Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link