rock2a

Ensembl ID:
ENSDARG00000017500
ZFIN ID:
ZDB-GENE-030115-3
Description:
rho-associated protein kinase 2 [Source:RefSeq peptide;Acc:NP_777288]
Human Orthologues:
ROCK1, ROCK2
Human Descriptions:
Rho-associated, coiled-coil containing protein kinase 1 [Source:HGNC Symbol;Acc:10251]
Rho-associated, coiled-coil containing protein kinase 2 [Source:HGNC Symbol;Acc:10252]
Mouse Orthologues:
Rock1, Rock2
Mouse Descriptions:
Rho-associated coiled-coil containing protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107927]
Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12939 Nonsense Available for shipment Available now
sa42240 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081971 Nonsense 139 1357 5 31
ENSDART00000133882 Nonsense 157 1375 5 31
Genomic Location (Zv9):
Chromosome 13 (position 33073170)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32719118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTGTGCGTTCCAGGATGACCGCTCTCTCTACATGGWAATGGAGTA[C/A]ATGCCAGGTGGAGATCTAGTCAATCTCACCAGCACATATGATGTCCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081971 Nonsense 531 1357 13 31
ENSDART00000133882 Nonsense 549 1375 13 31
Genomic Location (Zv9):
Chromosome 13 (position 33064831)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32710779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCAGAACTCGCACATCTCCAACGAGAAGAACATCCACCTGCAGAAA[C/T]AGGTTTGTACGTCTTTTCAGCCCATGACCCACTAAAATGAAGCACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link