rock2a

Ensembl ID:
ENSDARG00000017500
ZFIN ID:
ZDB-GENE-030115-3
Description:
rho-associated protein kinase 2 [Source:RefSeq peptide;Acc:NP_777288]
Human Orthologues:
ROCK1, ROCK2
Human Descriptions:
Rho-associated, coiled-coil containing protein kinase 1 [Source:HGNC Symbol;Acc:10251]
Rho-associated, coiled-coil containing protein kinase 2 [Source:HGNC Symbol;Acc:10252]
Mouse Orthologues:
Rock1, Rock2
Mouse Descriptions:
Rho-associated coiled-coil containing protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107927]
Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12939 Nonsense Available for shipment Available now
sa42240 Nonsense Mutation detected in F1 DNA During 2017
sa44793 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081971 Nonsense 139 1357 5 31
ENSDART00000133882 Nonsense 157 1375 5 31
Genomic Location (Zv9):
Chromosome 13 (position 33073170)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32719118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTGTGCGTTCCAGGATGACCGCTCTCTCTACATGGWAATGGAGTA[C/A]ATGCCAGGTGGAGATCTAGTCAATCTCACCAGCACATATGATGTCCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081971 Nonsense 531 1357 13 31
ENSDART00000133882 Nonsense 549 1375 13 31
Genomic Location (Zv9):
Chromosome 13 (position 33064831)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32710779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCAGAACTCGCACATCTCCAACGAGAAGAACATCCACCTGCAGAAA[C/T]AGGTTTGTACGTCTTTTCAGCCCATGACCCACTAAAATGAAGCACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081971 Nonsense 862 1357 20 31
ENSDART00000133882 Nonsense 880 1375 20 31
Genomic Location (Zv9):
Chromosome 13 (position 33056081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAAGTGCGAGAGCTGAAGGAGGAGTGTGAGGAGAAAAATAAACTTTA[T/G]AAAGACGTGCAGCAGAATCTACAGGAGCTGCAGGAGGAAAGGTGAGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link