
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cel.1
- Ensembl ID:
- ENSDARG00000017490
- ZFIN ID:
- ZDB-GENE-030131-1201
- Description:
- carboxyl ester lipase [Source:RefSeq peptide;Acc:NP_955901]
- Human Orthologue:
- CEL
- Human Description:
- carboxyl ester lipase (bile salt-stimulated lipase) [Source:HGNC Symbol;Acc:1848]
- Mouse Orthologue:
- Cel
- Mouse Description:
- carboxyl ester lipase Gene [Source:MGI Symbol;Acc:MGI:88374]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23865 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23865
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027784 | Nonsense | 446 | 550 | 10 | 11 |
ENSDART00000143952 | Nonsense | 448 | 552 | 10 | 11 |
The following transcripts of ENSDARG00000017490 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 21 (position 9834363)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11317726 GRCz11 21 11410354 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCATACCTGTTCACTGAGAGTTCTCGTATTCCTGTCTTCCCTCTGTG[G/A]ATGGGTGCCGATCATGCCGATGAACTTCAGTATGTGTTTGGAAAGCCTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: