cel.1

Ensembl ID:
ENSDARG00000017490
ZFIN ID:
ZDB-GENE-030131-1201
Description:
carboxyl ester lipase [Source:RefSeq peptide;Acc:NP_955901]
Human Orthologue:
CEL
Human Description:
carboxyl ester lipase (bile salt-stimulated lipase) [Source:HGNC Symbol;Acc:1848]
Mouse Orthologue:
Cel
Mouse Description:
carboxyl ester lipase Gene [Source:MGI Symbol;Acc:MGI:88374]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23865 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027784 Nonsense 446 550 10 11
ENSDART00000143952 Nonsense 448 552 10 11

The following transcripts of ENSDARG00000017490 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 9834363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCATACCTGTTCACTGAGAGTTCTCGTATTCCTGTCTTCCCTCTGTG[G/A]ATGGGTGCCGATCATGCCGATGAACTTCAGTATGTGTTTGGAAAGCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cli1tzed