fgd1

Ensembl ID:
ENSDARG00000017473
ZFIN ID:
ZDB-GENE-081104-33
Description:
Novel protein similar to vertebrate FYVE, RhoGEF and PH domain containing 3 (FGD3) [Source:UniProtKB
Human Orthologue:
FGD1
Human Description:
FYVE, RhoGEF and PH domain containing 1 [Source:HGNC Symbol;Acc:3663]
Mouse Orthologue:
Fgd1
Mouse Description:
FYVE, RhoGEF and PH domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:104566]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5468 Nonsense Mutation detected in F1 DNA During 2014
sa18906 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004921 Nonsense 637 839 14 17
ENSDART00000135398 Nonsense 355 555 10 13
ENSDART00000004921 Nonsense 637 839 14 17
ENSDART00000135398 Nonsense 355 555 10 13
Genomic Location:
Chromosome 8 (position 8363562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACTGTAATATTCTGACCGGTCTTTGTTTTCAGAATTGCTCAGAGCTT[G/T]GAAAGMGAGCGCCCACTCCGATCCGGGAGAAAGAAGTTACGCTGTGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004921 Nonsense 637 839 14 17
ENSDART00000135398 Nonsense 355 555 10 13
ENSDART00000004921 Nonsense 637 839 14 17
ENSDART00000135398 Nonsense 355 555 10 13
Genomic Location:
Chromosome 8 (position 8363562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTGTAATATTCTGACCGGTCTTTGTTTTCAGAATTGCTCAGAGCTT[G/T]GAAAGCGAGCGCCCACTCCGATCCGGGAGAAAGAAGTTACGCTGTGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/powss2u1