fgd1

Ensembl ID:
ENSDARG00000017473
ZFIN ID:
ZDB-GENE-081104-33
Description:
Novel protein similar to vertebrate FYVE, RhoGEF and PH domain containing 3 (FGD3) [Source:UniProtKB
Human Orthologue:
FGD1
Human Description:
FYVE, RhoGEF and PH domain containing 1 [Source:HGNC Symbol;Acc:3663]
Mouse Orthologue:
Fgd1
Mouse Description:
FYVE, RhoGEF and PH domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:104566]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34297 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004921 Essential Splice Site 632 839 14 17
ENSDART00000135398 Essential Splice Site 350 555 10 13
Genomic Location (Zv9):
Chromosome 8 (position 8363579)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7726111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTATGTCTGTGAATACTCACTGTAATATTCTGACCGGTCTTTGTTTTC[A/T]GAATTGCTCAGAGCTTGGAAAGCGAGCGCCCACTCCGATCCGGGAGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link