scg2a

Ensembl ID:
ENSDARG00000017470
ZFIN ID:
ZDB-GENE-030131-8214
Human Orthologue:
SCG2
Human Description:
secretogranin II [Source:HGNC Symbol;Acc:10575]
Mouse Orthologue:
Scg2
Mouse Description:
secretogranin II Gene [Source:MGI Symbol;Acc:MGI:103033]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5883 Nonsense Mutation detected in F1 DNA During 2017
sa22722 Nonsense Available for shipment Available now
sa35991 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003653 Nonsense 68 540 1 1
Genomic Location (Zv9):
Chromosome 15 (position 41873635)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43262152
KASP Assay ID:
554-3832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTATGGACCCCCATCCCAATTGCGCCCTCCTCCCAGCGCAGAGATGCTC[C/T]GAGCTCTACGATACATCCAAAGCCTCAGCGAGAGGACTCCAGCAGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003653 Nonsense 167 540 1 1
Genomic Location (Zv9):
Chromosome 15 (position 41873932)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43262449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACCAAAACAACAAGTGAAGGTGGACACAGATGATGGGAACTATGGG[A/T]GAAACTCGTGGGCTGAAAACCGGAGACGCTACAGAGAGTATCCAATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003653 Nonsense 242 540 1 1
Genomic Location (Zv9):
Chromosome 15 (position 41874157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCAAACGAAGTGATGATGATGAAGATGATGAAGAAGATTTATACAGG[C/T]AAAGGAAGATGGTCTTGGAGGACATCATGGGAACTGATGATTGGACGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link