ncam2

Ensembl ID:
ENSDARG00000017466
ZFIN ID:
ZDB-GENE-010822-1
Description:
neural cell adhesion molecule 2 [Source:RefSeq peptide;Acc:NP_571905]
Human Orthologue:
NCAM2
Human Description:
neural cell adhesion molecule 2 [Source:HGNC Symbol;Acc:7657]
Mouse Orthologue:
Ncam2
Mouse Description:
neural cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:97282]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34694 Nonsense Mutation detected in F1 DNA During 2017
sa38754 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18956 Nonsense Mutation detected in F1 DNA During 2017
sa31734 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062137 Nonsense 53 840 3 21
ENSDART00000100681 Nonsense 52 795 3 17
Genomic Location (Zv9):
Chromosome 9 (position 36281171)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35500682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGTATTTGTGTTTGTAGTGATCGGGGAGCCTGTGAAATTGGAGTG[G/A]TTTAACCCGCAGGGGGAGCGGATGGTCGCGTCTCCACGGGTGGCCTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062137 Essential Splice Site 113 840 4 21
ENSDART00000100681 Essential Splice Site 112 795 4 17
Genomic Location (Zv9):
Chromosome 9 (position 36268825)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35488336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTTCCAACAATGTAATCATTTTTACTATTTCTTCTCTCTGCCCCTC[A/C]GAGAAGCTGACGTTCAGAGATGTGAGGTCTCCTCAGGAGTTTCGGCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062137 Nonsense 475 840 11 21
ENSDART00000100681 Nonsense 471 795 11 17
Genomic Location (Zv9):
Chromosome 9 (position 36199502)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35419013
KASP Assay ID:
2260-2144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCATGGTTCTCAGGTTACTCCGATGTCAGACAGAGATTTTGGCCGTTA[C/A]AACTGCACAGCCAGAAACAACATCGGGATGCGCTTCCAGGAGTTCATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062137 Essential Splice Site 554 840 12 21
ENSDART00000100681 Essential Splice Site 550 795 12 17
Genomic Location (Zv9):
Chromosome 9 (position 36192182)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35411693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATCAGCTCACAGGACTGGAAGGATGTCAAATCGCTGGGGACGCAGAG[T/C]AAGTACAAAGGTTATCTGCTGCTACACTGAAATAAAAAAATATTAATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link