camk1d

Ensembl ID:
ENSDARG00000017446
ZFIN IDs:
ZDB-GENE-070112-1872, ZDB-GENE-070112-1872
Description:
calcium/calmodulin-dependent protein kinase 1D short [Source:RefSeq peptide;Acc:NP_001128515]
Human Orthologue:
CAMK1D
Human Description:
calcium/calmodulin-dependent protein kinase ID [Source:HGNC Symbol;Acc:19341]
Mouse Orthologue:
Camk1d
Mouse Description:
calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI Symbol;Acc:MGI:2442190]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12010 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014964 Nonsense 125 368 4 11
ENSDART00000104674 Nonsense 125 392 4 11
Genomic Location:
Chromosome 25 (position 8265380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCGCATCGTGGAGARGGGCTTTTACACGGAGCAGGACGCCAGTGCGT[T/A]AATCAAACAAGTTCTRGATGCTGTAAATTACCTGCACTCGCTCGGGATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/84rx24gs