eif3s2

Ensembl ID:
ENSDARG00000017445
ZFIN ID:
ZDB-GENE-040426-1922
Description:
Eukaryotic translation initiation factor 3 subunit I [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV55]
Human Orthologue:
EIF3I
Human Description:
eukaryotic translation initiation factor 3, subunit I [Source:HGNC Symbol;Acc:3272]
Mouse Orthologue:
Eif3i
Mouse Description:
eukaryotic translation initiation factor 3, subunit I Gene [Source:MGI Symbol;Acc:MGI:1860763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18588 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005119 Nonsense 87 325 5 11
Genomic Location:
Chromosome 19 (position 31075686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACATTCTTGTTGAATGAYGTTTGTGTGTTGTTTGCTCAGGAAAGCAGT[T/A]GGCTCTGCTGGAGACCAGTTCAGCCGTGAGGACGTGTGGCTTTGACTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pm3qevx1