hal

Ensembl ID:
ENSDARG00000017444
ZFIN ID:
ZDB-GENE-070410-5
Description:
histidine ammonia-lyase [Source:RefSeq peptide;Acc:NP_001082926]
Human Orthologue:
HAL
Human Description:
histidine ammonia-lyase [Source:HGNC Symbol;Acc:4806]
Mouse Orthologue:
Hal
Mouse Description:
histidine ammonia lyase Gene [Source:MGI Symbol;Acc:MGI:96010]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17525 Nonsense Available for shipment Available now
sa24611 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025928 Nonsense 58 654 1 20
Genomic Location:
Chromosome 25 (position 8237652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGAGGAATCAAGCATGTCAAAGAAGTGTGTTTCGTGGKCAGGAGGTG[T/A]CAGGGYTTTGGGCTTCTGGACAATGATGATATCGTAGAAGATGTGCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025928 Nonsense 218 654 8 20
Genomic Location:
Chromosome 25 (position 8229791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAGTCCCGAAAGAACCCGAATGCTGCTCGCTCTGAGGATTAATGTTT[T/A]GGCCAAAGGACACAGCGGGGTTTCACCGGAGACGCTGCACAGCATGATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9y7saw4k