adcy3

Ensembl ID:
ENSDARG00000017437
ZFIN ID:
ZDB-GENE-041014-276
Description:
Novel protein similar to vertebrate adenylate cyclase 3 (ADCY3) [Source:UniProtKB/TrEMBL;Acc:Q5SP66]
Human Orthologue:
ADCY3
Human Description:
adenylate cyclase 3 [Source:HGNC Symbol;Acc:234]
Mouse Orthologue:
Adcy3
Mouse Description:
adenylate cyclase 3 Gene [Source:MGI Symbol;Acc:MGI:99675]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1806 Missense F2 line generated During 2014
sa10668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1806
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016530 Missense 207 1100 2 23
ENSDART00000148071 Missense 208 1053 2 20
Genomic Location:
Chromosome 20 (position 46915125)
KASP Assay ID:
554-1798.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTTGCAGCTCGTGGCGAATCTGATGYTGTATTTTGGTGCCATGCTG[G/T]TGGGTGTGATGTCATATTTCATGGCTGACCGTAAATACCGCACAGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016530 Nonsense 861 1100 18 23
ENSDART00000148071 Nonsense 814 1053 15 20
Genomic Location:
Chromosome 20 (position 46938561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACATACAACGAGGCGCTGGTCACAAATATGCTTCCCGAACACGTGGCC[A/T]AACACTTCYTGGGCTCCAAGAAGCGAGATGAGGTGTGCATNAAAACTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Meta-analysis identifies common variants associated with body mass index in east Asians. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)
  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hy3nq0mz