si:busm1-199m19.4

Ensembl ID:
ENSDARG00000017431
ZFIN ID:
ZDB-GENE-030616-328
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q801X0]
Human Orthologue:
FAM63B
Human Description:
family with sequence similarity 63, member B [Source:HGNC Symbol;Acc:26954]
Mouse Orthologue:
Fam63b
Mouse Description:
family with sequence similarity 63, member B Gene [Source:MGI Symbol;Acc:MGI:2443086]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16284 Nonsense Available for shipment Available now
sa20976 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027466 Nonsense 193 625 1 9
Genomic Location (Zv9):
Chromosome 7 (position 31830770)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30223112
KASP Assay ID:
2259-8984.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCCCGCAGCTTTGATTCACTCGAGTCCTTCTCCAACCTGAACTCCTG[T/A]CCGAGTTCAGACCTCAACAGTGAAGGACTGGAGGAGAAGGGACTGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027466 Nonsense 291 625 2 9
Genomic Location (Zv9):
Chromosome 7 (position 31834837)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30227179
KASP Assay ID:
2259-8985.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCCACCAATGATGGAAATGATAACGGCAGAGCAGCTGATGGAATA[T/A]CTGGGTGAGCATTTCATTTGCATCACAATTGTGGATTTTCTTGACATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link