ENSDARG00000017425

Ensembl ID:
ENSDARG00000017425
Human Orthologue:
AC104809.3

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20707 Nonsense Mutation detected in F1 DNA During 2014
sa20708 Nonsense Mutation detected in F1 DNA During 2014
sa5752 Nonsense F2 line generated During 2014
sa2292 Nonsense Available for shipment Available now
sa20709 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25339 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065238 Nonsense 272 1959 8 37
Genomic Location:
Chromosome 6 (position 27118754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTGCCGACCATATGTCCATATCATCATTCTGCAGATGAATACCTCC[C/T]GAAACAGCCGCGAACAAGTCCGTGTACGATCTTTGTGGCGTCAAGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065238 Nonsense 585 1959 14 37
Genomic Location:
Chromosome 6 (position 27124011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAACAGAGCAGGAAGGTTTGAGAAGTTCCTCTCTGGATGTTCAGAGG[C/T]AGAGAGACCTCCTCAGGCAGCAGAGGGAGGACCTGGAGAGGCAGCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5752
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065238 Nonsense 873 1959 19 37
ENSDART00000065238 Nonsense 873 1959 19 37
Genomic Location:
Chromosome 6 (position 27131043)
KASP Assay ID:
554-2612.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAAGCCTGTTGGACAGGCAGGAACTGGCCTCATCTCTAGAGGCCATA[C/T]GAGATAGACTAGATGGAGAGAATGCTAGTCTACAGCAGGCTAACAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065238 Nonsense 873 1959 19 37
ENSDART00000065238 Nonsense 873 1959 19 37
Genomic Location:
Chromosome 6 (position 27131043)
KASP Assay ID:
554-2612.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAAGCCTGTTGGACAGGCAGGAACTGGCCTCATCTCTAGAGGCCATA[C/T]GAGATAGACTAGATGGAGAGAATGCTAGTCTACAGCAGGCTAACAAGTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065238 Essential Splice Site 891 1959 19 37
Genomic Location:
Chromosome 6 (position 27131101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGATGGAGAGAATGCTAGTCTACAGCAGGCTAACAAGTCCTTGACGC[G/T]TGAGTTTCTCTCCAGGGAGCCTTTATCCTACTCTCATTGACTTGGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065238 Nonsense 1398 1959 27 37
Genomic Location:
Chromosome 6 (position 27140705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAATTCTACTTTGAGACGTACACTCGGATCCAGGCGTGGAAGGCAAT[C/A]ACCCACACCTGGGGAACGAGGACGGAGCCCCTCGCCATGGAGAACTCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fdcgml5q