patl1

Ensembl ID:
ENSDARG00000017423
ZFIN ID:
ZDB-GENE-070209-83
Description:
Protein PAT1 homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:A2RRV3]
Human Orthologue:
PATL1
Human Description:
protein associated with topoisomerase II homolog 1 (yeast) [Source:HGNC Symbol;Acc:26721]
Mouse Orthologue:
Patl1
Mouse Description:
protein associated with topoisomerase II homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147679]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11013 Nonsense Available for shipment Available now
sa18712 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100937 Nonsense 745 765 17 18
ENSDART00000139577 Nonsense 745 758 17 17
ENSDART00000100937 Nonsense 745 765 17 18
ENSDART00000139577 Nonsense 745 758 17 17

The following transcripts of ENSDARG00000017423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 53264201)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52133772
KASP Assay ID:
2259-1169.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCACCGCTGTTCACTCCTCCAAACCTGGTGTCTCTGTTCTCTCGATA[T/A]GTGGACCGCCAGAGACTTGAACTCTTACAGGAGAAACTACAGTGAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100937 Nonsense 745 765 17 18
ENSDART00000139577 Nonsense 745 758 17 17
ENSDART00000100937 Nonsense 745 765 17 18
ENSDART00000139577 Nonsense 745 758 17 17

The following transcripts of ENSDARG00000017423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 53264201)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52133772
KASP Assay ID:
2259-1169.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCACCGCTGTTCACTCCTCCAAACCTGGTGTCTCTGTTCTCTCGATA[T/A]GTGGACCGCCAGAGACTTGAACTCTTACAGGAGAAACTACAGTGAGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link