bscv

Ensembl ID:
ENSDARG00000017422
ZFIN ID:
ZDB-GENE-020919-1
Description:
Adipocyte plasma membrane-associated protein [Source:UniProtKB/Swiss-Prot;Acc:Q803F5]
Human Orthologue:
C20orf3
Human Description:
chromosome 20 open reading frame 3 [Source:HGNC Symbol;Acc:13238]
Mouse Orthologue:
2310001A20Rik
Mouse Description:
RIKEN cDNA 2310001A20 gene Gene [Source:MGI Symbol;Acc:MGI:1919131]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8842 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025910 Essential Splice Site 31 415 1 9
Genomic Location (Zv9):
Chromosome 13 (position 5897336)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6091361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCACATAATCACAGACGAAACCCACGAACCCCAGTATAAAGCCACAAG[G/T]TGAGACACTTTCCATTGCTCTGGCCCACACAYTTAGTCATTTATTAAWTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link