si:ch73-6o20.1

Ensembl ID:
ENSDARG00000017391
ZFIN ID:
ZDB-GENE-100921-10
Human Orthologue:
UNC13B
Human Description:
unc-13 homolog B (C. elegans) [Source:HGNC Symbol;Acc:12566]
Mouse Orthologue:
Unc13b
Mouse Description:
unc-13 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1342278]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9739 Nonsense Available for shipment Available now
sa14652 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064752 Nonsense 107 1192 3 31
ENSDART00000128664   None 255 None 7
ENSDART00000131918   None 267 None 8
ENSDART00000140710 Nonsense 84 761 2 18

The following transcripts of ENSDARG00000017391 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 20950970)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18663827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGTATTGCGMGGCAGGGCATGCGCTGCTCAGAGTGTGGAGTCAAATG[C/A]CAYGAAAAATGCCAAGAGCTTCTCAACGCAGACTGTTTGCARAGTGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064752 Nonsense 577 1192 14 31
ENSDART00000128664   None 255 None 7
ENSDART00000131918   None 267 None 8
ENSDART00000140710 Nonsense 552 761 12 18

The following transcripts of ENSDARG00000017391 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 20976737)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18689594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTCAYCACCCTGATAGTGTCCATCATAGAGGAGGATAAGAATGCCTA[C/A]AACCCCGTTATCAATCAGTCAGTCACTGCAGACACACAATATTACACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study identifies candidate genes for Parkinson's disease in an Ashkenazi Jewish population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link