gstt1b

Ensembl ID:
ENSDARG00000017388
ZFIN ID:
ZDB-GENE-040426-1491
Description:
glutathione S-transferase theta 1b [Source:RefSeq peptide;Acc:NP_956878]
Human Orthologues:
GSTT1, GSTT2, GSTT2B
Human Descriptions:
glutathione S-transferase theta 1 [Source:HGNC Symbol;Acc:4641]
glutathione S-transferase theta 2 [Source:HGNC Symbol;Acc:4642]
glutathione S-transferase theta 2B (gene/pseudogene) [Source:HGNC Symbol;Acc:33437]
Mouse Orthologues:
Gstt1, Gstt2, Gstt3, Gstt4
Mouse Descriptions:
glutathione S-transferase, theta 1 Gene [Source:MGI Symbol;Acc:MGI:107379]
glutathione S-transferase, theta 2 Gene [Source:MGI Symbol;Acc:MGI:106188]
glutathione S-transferase, theta 3 Gene [Source:MGI Symbol;Acc:MGI:2143526]
glutathione S-transferase, theta 4 Gene [Source:MGI Symbol;Acc:MGI:1923136]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37262 Nonsense Mutation detected in F1 DNA During 2017
sa14837 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23892 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015841 Nonsense 41 242 2 5
Genomic Location (Zv9):
Chromosome 21 (position 13917629)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15618584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGTGTTTTGCTTAAAAATGAGCATATGTTCCTTCAGGTTATCAATA[T/A]GGTGAAGAATTTGGAAAAATCAACCCACTAAGAAAATTCCCAACAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015841 Essential Splice Site 67 242 2 5
Genomic Location (Zv9):
Chromosome 21 (position 13917708)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15618663
KASP Assay ID:
1641-0501.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAAAATTCCCAACAATCAAAGATGGAGACTTTTGCTTAGCTGAAAGG[T/C]AAGTGACTTTGCAAGCAAGTTTAGCCTTCAATTTACGACCTAAGATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015841 Nonsense 89 242 3 5
Genomic Location (Zv9):
Chromosome 21 (position 13919226)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15620181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACCTGGCTGACAAATTCCACACTCCAGACCATTGGTTTCCAGCGGACT[T/A]GCAGAAGCGAGCTAGAGTAAATGAATATCTGTCGTGGCAGCACACTTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link