si:ch211-152c2.4

Ensembl ID:
ENSDARG00000017386
ZFIN ID:
ZDB-GENE-041210-8
Description:
Sine oculis-binding protein homolog [Source:UniProtKB/Swiss-Prot;Acc:A7XYJ6]
Human Orthologue:
SOBP
Human Description:
sine oculis binding protein homolog (Drosophila) [Source:HGNC Symbol;Acc:29256]
Mouse Orthologue:
Sobp
Mouse Description:
sine oculis-binding protein homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924427]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26185 Nonsense Mutation detected in F1 DNA During 2017
sa40195 Nonsense Mutation detected in F1 DNA During 2017
sa30844 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006961 Nonsense 124 668 3 6
ENSDART00000135618 Nonsense 124 668 3 7
Genomic Location (Zv9):
Chromosome 4 (position 600214)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 818130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATCCTCCAACTGTTCCTGTGTCTCCCTCTGCATCTTCAGCCTCGCCA[C/T]GACACAACATGAACGTCATCGTGCCGCTCATCAAACCCTCCGCAGGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006961 Nonsense 566 668 6 6
ENSDART00000135618 Nonsense 566 668 6 7
ENSDART00000006961 Nonsense 566 668 6 6
ENSDART00000135618 Nonsense 566 668 6 7
Genomic Location (Zv9):
Chromosome 4 (position 592349)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 810265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCCCGTCGCCTCTGTCTGACTGTGAGGATGTGAAGGAGAATAGCTA[T/A]TTATGTGGGCGGGGCAATGACTCAGCCAATCAGTGGACGGCAGAGCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006961 Nonsense 566 668 6 6
ENSDART00000135618 Nonsense 566 668 6 7
ENSDART00000006961 Nonsense 566 668 6 6
ENSDART00000135618 Nonsense 566 668 6 7
Genomic Location (Zv9):
Chromosome 4 (position 592349)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 810265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCCCGTCGCCTCTGTCTGACTGTGAGGATGTGAAGGAGAATAGCTA[T/A]TTATGTGGGCGGGGCAATGACTCAGCCAATCAGTGGACGGCAGAGCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link