sema3d

Ensembl ID:
ENSDARG00000017369
ZFIN ID:
ZDB-GENE-990715-2
Description:
Semaphorin-3D [Source:UniProtKB/Swiss-Prot;Acc:Q9W6G6]
Human Orthologue:
SEMA3D
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D [Source:HGNC
Mouse Orthologue:
Sema3d
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D Gene [Source:

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36576 Nonsense Mutation detected in F1 DNA During 2017
sa30702 Nonsense Mutation detected in F1 DNA During 2017
sa19196 Nonsense Mutation detected in F1 DNA During 2017
sa1661 Nonsense Available for shipment Available now
sa28980 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43051 Nonsense Mutation detected in F1 DNA During 2017
sa44882 Nonsense Mutation detected in F1 DNA During 2017
sa15069 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192 Nonsense 11 291 2 8
ENSDART00000127469 Nonsense 11 766 2 18
Genomic Location (Zv9):
Chromosome 18 (position 8651036)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9228414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAATCTCCTCGTCCATCATGAAGACTGCAGGGGAGCCGGACAGACGG[A/T]GACAGAGGAGACAGGTCAGGACGGGACGGTTTTCATGTGCTTGGTGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192 Nonsense 15 291 2 8
ENSDART00000127469 Nonsense 15 766 2 18
Genomic Location (Zv9):
Chromosome 18 (position 8651048)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9228426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCCATCATGAAGACTGCAGGGGAGCCGGACAGACGGAGACAGAGGAGA[C/T]AGGTCAGGACGGGACGGTTTTCATGTGCTTGGTGGTCTACATCAGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192 Nonsense 41 291 2 8
ENSDART00000127469 Nonsense 41 766 2 18
Genomic Location (Zv9):
Chromosome 18 (position 8651128)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9228506
KASP Assay ID:
2261-1870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGTCTACATCAGTGATGCTCTTCTTCTCTCTGCCTGAGGGGAACTG[C/A]ATGAAGGAAAGTTTGCCAAGAGTTAAACTCGGCTACAAAGGTAAAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192 Nonsense 257 291 8 8
ENSDART00000127469 Nonsense 257 766 8 18
Genomic Location (Zv9):
Chromosome 18 (position 8677228)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9254606
KASP Assay ID:
554-1608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCTACAGAGGGCAAGTTCATTTCTGCCCATCCCATCTCAGACACCTA[C/A]AATCCTGACGATGACAAGATTTACTTCTTTTTCCGTGAGGCTTCTCGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa28980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192   291 291 8 8
ENSDART00000127469 Essential Splice Site 291 766 8 18
Genomic Location (Zv9):
Chromosome 18 (position 8677331)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9254709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCACTACAGACAAGAGCGTGCTGTCTCGTGTCGCCCGGATCTGCAGG[G/A]TAAGGCCCGTCCTCACGCTGCCTGATCACAGAGAAACTCACCTCATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192   None 291 None 8
ENSDART00000127469 Nonsense 318 766 9 18
Genomic Location (Zv9):
Chromosome 18 (position 8680960)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9258338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACAAGTGGACAACATTTCTCAAAGCGAGACTCGTGTGCTCCATTCCT[G/T]GACCAGATGGAGTGGACACACACTTTGATGAGCTCCGTGAGTGATGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192   None 291 None 8
ENSDART00000127469 Nonsense 597 766 17 18
Genomic Location (Zv9):
Chromosome 18 (position 8693646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTTTTGATATGCTGATCGCTCCCTCTCTCTTTCGCTTTTGCAGTGT[T/A]AGGGAGGAATGTCGAGGAGAAGGTGTTGTACGGAGTGGAGAGTAACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101192   None 291 None 8
ENSDART00000127469 Essential Splice Site 641 766 17 18
Genomic Location (Zv9):
Chromosome 18 (position 8693781)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9271159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGAWCCGCTGGTTTGTACTGAAGCCAGGAGTGGACCACCGTCAAGAGG[T/C]ATCAGTAACCTAGAGTRYATCAGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link